A practical reference on NAD+: what it is, how it behaves, what the literature reports, and where the honest uncertainties sit.
This page was last updated on 2025-12-30 and is reviewed periodically as new material appears.
The term NMN commonly refers to the beta isomer, in which the nicotinamide group is attached to the ribose through a beta-glycosidic bond. Commercial material may be supplied as the free acid or as a salt, such as a sodium salt, which affects molecular weight and water solubility. Related compounds include nicotinamide riboside and NAD+ itself, but these are distinct molecules with different formulas and cellular handling. Laboratory research often uses the beta form because it matches the naturally occurring configuration found in biological systems.
Small amounts of NMN occur in some foods, including certain vegetables, fruits, and animal products, though the quantities are generally low and variable. Human cells also synthesize NMN internally from nicotinamide and other precursors. Research interest increased after studies examined whether raising NAD+ levels affects metabolism and aging-related pathways in animals. Evidence in humans remains limited and mixed for many outcomes, and questions about effective absorption, tissue delivery, and long-term effects are still open. Regulatory status differs by country, with some markets treating NMN as a supplement ingredient and others restricting its sale.
Nicotinamide mononucleotide, usually shortened to NMN, is a naturally occurring nucleotide. Its structure consists of a nicotinamide base linked to a ribose sugar that carries a phosphate group. In cells, NMN serves as an intermediate in the salvage pathway that produces nicotinamide adenine dinucleotide, or NAD+. Because NAD+ participates in many oxidation-reduction reactions, NMN sits near central metabolic processes. The compound is not a drug in most jurisdictions and is discussed mainly in biochemistry and nutrition research.
NMN occurs in many living systems, including bacteria, yeast, plants, and mammals. Dietary sources are present in foods such as edamame, avocado, broccoli, and various meats, but amounts vary widely and are generally lower than those used in research settings. Laboratory production often relies on enzymatic synthesis or chemical phosphorylation of nicotinamide riboside, and commercial material is typically supplied as a white to off-white powder. Because NMN is hygroscopic and sensitive to heat, moisture, and pH extremes, its handling requires care to preserve identity and purity. Aqueous preparation should be done with attention to pH and temperature to limit hydrolysis.
Nicotinamide mononucleotide, abbreviated NMN, is a naturally occurring nucleotide found in cells. Its structure consists of a nicotinamide ring linked to ribose phosphate, and the compound serves as an intermediate in the salvage pathway for nicotinamide adenine dinucleotide, or NAD+. In this pathway, nicotinamide phosphoribosyltransferase converts nicotinamide and phosphoribosyl pyrophosphate into NMN, after which NMN adenylyltransferase attaches an adenylate group to produce NAD+. Because NAD+ participates in redox reactions and signaling, NMN occupies a central position in cellular metabolism. The molecule is distinct from nicotinamide riboside, though the two are related in NAD+ precursor research.
| Property | Value | Notes |
|---|---|---|
| Chemical name | beta-Nicotinamide mononucleotide | Free acid and salt forms share the core structure. |
| Molecular formula | C11H15N2O8P | Calculated for the free acid; salt forms add counterions. |
| Molar mass | 334.22 g/mol | Approximate value for the free acid form. |
| Appearance | White to off-white powder | Color and texture can vary with purity and salt form. |
| Solubility | Water-soluble | Typically soluble in aqueous media; less soluble in nonpolar solvents. |
Dietary sources of NMN include small amounts in certain vegetables, fruits, and other foods, although exact values vary by sample and method. Endogenous NMN concentrations are tightly regulated and often low, making measurement in blood or tissues technically demanding. After oral intake, NMN is thought to be rapidly metabolized in the intestine and liver, and intact NMN may not reach all tissues at high levels. Some rodent studies report increases in tissue NAD+ after oral NMN, while human data remain limited and sometimes rely on blood NAD+ metabolites rather than direct tissue measures.
Research on NMN has focused on aging, metabolic regulation, exercise capacity, and insulin sensitivity, but findings are preliminary. Many human trials are small, short in duration, and use different endpoints, which complicates comparison across studies. No national regulator has approved NMN as a therapeutic drug for any indication. In some countries it is sold as a supplement or research chemical, while other jurisdictions have questioned its status under food or supplement laws. Claims about extending human lifespan or reversing aging are not supported by established clinical evidence.
Nicotinamide mononucleotide, commonly abbreviated NMN, is a naturally occurring nucleotide. Its structure combines a nicotinamide ring with a ribose sugar and a phosphate group. The compound appears in cells across many organisms as an intermediate in the production of nicotinamide adenine dinucleotide, or NAD+. Because NMN sits close to NAD+ in metabolism, it has drawn interest in biochemistry and aging research. The molecule is not a dietary essential nutrient in the classical sense, and its presence in food is generally low and variable.
NAD+ serves as a coenzyme in redox reactions and as a substrate for enzymes involved in DNA repair and cellular signaling. In the salvage pathway, nicotinamide is converted to NMN by the enzyme NAMPT. NMN is then converted to NAD+ by NMNAT enzymes. A separate route links nicotinamide riboside to NMN through phosphorylation. These pathways maintain NAD+ levels, which can decline with age or metabolic stress in some tissues. The relative contribution of circulating NMN to tissue NAD+ remains an active area of study.
Nicotinamide mononucleotide, abbreviated NMN, is a naturally occurring nucleotide. Its structure combines a nicotinamide base with a ribose sugar and a phosphate group. Within cells, NMN sits on the biosynthetic route that recycles nicotinamide back into nicotinamide adenine dinucleotide, or NAD+. Because NAD+ participates in redox reactions and signaling, enzymes that produce and consume it influence many metabolic processes. The compound is therefore best described as an intermediate rather than a final signaling molecule.
In the canonical salvage pathway, nicotinamide phosphoribosyltransferase, known as NAMPT, transfers a phosphoribosyl group to nicotinamide and releases NMN. A second enzyme, NMN adenylyltransferase, then attaches an adenylyl group to NMN to form NAD+. Alternative routes exist, including a pathway that uses nicotinamide riboside and its phosphorylated forms. The relative contribution of extracellular NMN to intracellular NAD+ pools remains an area of active investigation, and the roles of specific transporters and enzymes are not completely defined.
NMN is present in small amounts in various foods, including certain vegetables, fruits, and milk, though dietary quantities are generally low. Laboratory research often uses synthetic or enzymatically produced NMN. The compound has drawn interest because NAD+ levels decline with age in some tissues and because restoring NAD+ may affect metabolism in animal models. Whether oral NMN produces meaningful NAD+ increases in humans and whether such changes translate into health benefits are not fully established.
Nicotinamide mononucleotide, abbreviated NMN, is a naturally occurring nucleotide found in cells. Its structure combines a nicotinamide ring, a ribose sugar, and a phosphate group. As an intermediate in the NAD+ salvage pathway, NMN is converted to nicotinamide adenine dinucleotide, a coenzyme central to cellular redox reactions. NAD+ also serves as a substrate for enzymes involved in DNA repair, stress responses, and metabolic regulation. The compound is therefore part of normal cellular biochemistry rather than an exclusively synthetic molecule.
Two enzymatic steps define the canonical route from nicotinamide to NAD+. Nicotinamide phosphoribosyltransferase, known as NAMPT, produces NMN from nicotinamide and phosphoribosyl pyrophosphate. NMN adenylyltransferases, or NMNAT enzymes, then couple NMN with ATP to form NAD+. Whether intact NMN crosses cell membranes efficiently remains an active area of investigation; some studies propose direct transport, while others emphasize extracellular dephosphorylation to nicotinamide riboside followed by uptake. The relative contribution of each route likely depends on cell type, tissue, and experimental conditions.
The number average molecular mass of a polymer can be determined by gel permeation chromatography, viscometry via the (Mark–Houwink equation), colligative methods such as vapor pressure osmometry, end-group determination or proton NMR. High number-average molecular mass polymers may be obtained only with a high fractional monomer conversion in the case of step-growth polymerization, as per the Carothers' equation.
The series begins with a streamer (WayneRadioTV) playing a mod of Half-Life with VR support and intelligent AI characters. He begins a Let's Play, roleplaying as Gordon Freeman. Freeman is walking through the Black Mesa Research Facility and encounters Benry (Socpens), an antagonistic security guard who demands he provide a passport for identification, and begins to follow and taunt him. Freeman also comes across three eccentric scientists: Tommy Coolatta (Baaulp), who is childlike and book smart, Dr. Harold Coomer (Hollow_tones), who is friendly and the subject of frequent glitches, and Dr. Bubby (MasterGir), who is cranky and acts rude towards Freeman. Freeman and the scientists experiment on a crystal of unknown origin, which goes awry and triggers a resonance cascade. Freeman, the scientists, and Benry, collectively called "the science team", make their way through the damaged facility while fighting alien creatures and members of the US military, including an obstinate Marine named Forzen (Socpens). During the journey, Coomer accidentally noclips out of the map, causing him to suspect he may be in a video game. Freeman is betrayed by Bubby and Benry, leading him to be captured by the government soldiers deployed to clean up the incident. The soldiers cut off his arm and throw him into a trash compactor. A delirious Freeman comes to and makes his way to an abandoned section of Black Mesa where he rejoins Tommy. He then encounters Coomer, who attempts to use Freeman as a way to escape the video game using several clones of himself.
Systemin plays a critical role in defence signalling in tomato. It promotes the synthesis of over 20 defence-related proteins, mainly antinutritional proteins, signaling pathway proteins and proteases. The over-expression of the prosystemin resulted in a significant decrease of the larvae damage, indicating that a high level of constitutive protection is superior to an inducible defence mechanism. However, the continuous activation of prosystemin is costly, affecting the growth, the physiology and the reproductive success of tomato plants. When systemin was silenced, production of protease inhibitors in tomato was severely impaired and larvae feeding on the plants grew three times as fast. HypSys caused similar changes in gene expression in tobacco, for example polyphenol oxidase activity increased tenfold in tobacco leaves and protease inhibitors caused a 30% decrease in chymotrypsin activity within three days of wounding. When HypSys was over-expressed in tobacco, larvae feeding on transgenic plants weighed half as much after ten days feeding, as those feeding on normal plants. The concentration of hydrogen peroxide increased in the vasculature tissues when the production of systemin, HypSys or AtPep1 is induced, this may also be involved in initiating systemic acquired resistance. Tomato plants over-expressing systemin also accumulated HypSys but did not if the systemin precursor was silenced, indicating that in tomato, HypSys is controlled by systemin. Each of the three HypSys peptides in tomato is able to activate the synthesis and accumulation of protease inhibitors.
Another submarine, USS Cavalla, was able to maneuver to an attack position on the 25,675-ton carrier Shōkaku by about noon. The submarine fired a spread of six torpedoes, three of which struck Shōkaku on her starboard side. Badly damaged, the carrier came to a halt. One torpedo had hit the forward aviation fuel tanks near the main hangar, and aircraft that had just landed and were being refueled exploded into flames. Ammunition and exploding bombs added to the conflagration, as did burning fuel spewing from shattered fuel pipes. With her bows subsiding into the sea and fires out of control, the captain gave orders to abandon ship. Within minutes, there was a catastrophic explosion of aviation fuel vapor which had built up between decks, which blew the ship apart. The carrier rolled over and sank about 140 miles (230 km) north of the island of Yap. 887 crew and 376 men of the 601st Naval Air Group, 1,263 men in all, were killed. There were 570 survivors, including the carrier's commanding officer, Captain Hiroshi Matsubara. Destroyer Urakaze attacked the submarine, but Cavalla escaped with relatively minor damage despite near misses from depth charges. Meanwhile, Taihō was falling victim to poor damage control. Hoping to clear the explosive fumes, an inexperienced damage-control officer ordered her ventilation system to operate at full blast. This action instead spread the vapors throughout Taihō, putting the entire vessel at risk.
Halliwell B, Watt F, Minqin R. (2023) Iron and atherosclerosis: Lessons learned from rabbits relevant to human disease. Free Radic. Biol. Med. 209, 165–170. Yau YF, Cheah IK, Mahendran R, Tang RMY, Chua RY, Goh RES, Feng L, Li J, Kua EH, Chen C, Halliwell B. (2024) Investigating the efficacy of ergothioneine to delay cognitive decline in mild cognitively impaired subjects: A pilot study. J. Alzheimer's Disease 102, 841–854.
Sources: en.wikipedia.org
In pre-life, a 31 nucleotide D loop minihelix (GCGGCGGUAGCCUAGCCUAGCCUACCGCCGC) was ligated to two 31 nucleotide anticodon loop minihelices (GCGGCGGCCGGGCU/???AACCCGGCCGCCGC; / indicates a U-turn conformation in the RNA backbone; ? indicates unknown base identity) to form the 93 nucleotide tRNA precursor. To generate type II tRNAs, a single internal 9 nucleotide deletion occurred within ligated acceptor stems (CCGCCGCGCGGCGG goes to GGCGG). To generate type I tRNAs, an additional, related 9 nucleotide deletion occurred within ligated acceptor stems within the variable loop region (CCGCCGCGCGGCGG goes to CCGCC). These two 9 nucleotide deletions are identical on complementary RNA strands. tRNAomes (all of the tRNAs of an organism) were generated by duplication and mutation. Very clearly, life evolved from a polymer world that included RNA repeats and RNA inverted repeats (stem-loop-stems). Of particular importance were the 7 nucleotide U-turn loops (CU/???AA). After LUCA (the last universal common (cellular) ancestor), the T loop evolved to interact with the D loop at the tRNA "elbow" (T loop: UU/CAAAU, after LUCA). Polymer world progressed to minihelix world to tRNA world, which has endured for ~4 billion years. Analysis of tRNA sequences reveals a major successful pathway in evolution of life on Earth.
He'd say, 'Hey, I did this. Not you.'" Starr still blamed himself for the death of Staley, and had kept the story a secret until his appearance on Celebrity Rehab. During this same interview, Staley's mother recalled that he had attempted rehab fourteen times, although it is not clear whether any of these attempts were during his reclusive years. Starr was found dead on March 8, 2011, as a result of a prescription drug overdose.
=== Brazil === Stroganoff is a popular dish in Brazil, where it is known as estrogonofe or strogonoff. Estrogonofe is generally prepared with tomato paste or ketchup and mushrooms. Chicken is sometimes used instead of beef. Estrogonofe is generally eaten with cooked white rice and shoestring fries (batata palha).
In December 2005, Eli Lilly and Company pleaded guilty and paid $36 million in connection with the illegal promotion of Raloxifene (Evista), a medication typically used to prevent and treat osteoporosis in postmenopausal women. Sales representatives were trained to promote Evista for breast cancer and cardiovascular disease, to prompt or bait questions from doctors, and to send them unsolicited letters promoting Evista for unapproved use. The company also distributed a videotape in which a sales representative declared that "Evista truly is the best drug for the prevention of all these diseases." Some sales representatives had also been instructed to conceal the disclosure page which stated that the effectiveness of the drug in reducing breast cancer risks had not yet been established.
Sources: en.wikipedia.org
The concept was successful enough to become a permanent fixture of the chain, and Little Caesars' business model has shifted to focus more on carryout. In 1998, Little Caesars filled what was then the largest pizza order, filling an order of 13,386 pizzas from the VF Corporation of Greensboro, North Carolina. Little Caesars was among the first to use a new kind of speed-cooking conveyor oven, the "Rotary Air Impingement Oven". On December 10, 2014, Little Caesars announced plans for a new eight-story, 205,000-square-foot Global Resource Center to be built at Woodward Avenue and Columbia Street in downtown Detroit. Intended to double the size of Little Caesars World Headquarters Campus, the new building's location was chosen near the Fox Office Center building, which houses both the Fox Theatre, and 186,000 square feet of office space for Little Caesars, and other Ilitch-affiliated ventures. An overhead pedestrian bridge over Columbia Street was planned to connect the Fox with the new Little Caesars Global Resource Center and workspace for an additional 600 jobs to be brought to Detroit over time. On January 31, 2016, it was announced that the proposed new Little Caesars Pizza Global Resource Center had grown by one floor to be a nine-story building at Woodward and Columbia Street. The building was scheduled to be completed in 2018, but in October of that year, was pushed back due to construction delays.
== Structure == Drosophila contain a single Notch protein, C. elegans contain two redundant notch paralogs, Lin-12 and GLP-1, and humans have four Notch variants, Notch 1-4. Although variations exist between homologs, there are a set of highly conserved structures found in all Notch family proteins. The protein can broadly be split into the Notch extracellular domain (NECD) and Notch intracellular domain (NICD) joined together by a single-pass transmembrane domain (TM). The NECD contains 36 EGF repeats in Drosophila, 28-36 in humans, and 13 and 10 in C. elegans Lin-12 and GLP-1 respectively. These repeats are heavily modified through O-glycoslyation and the addition of specific O-linked glycans has been shown to be necessary for proper function. The EGF repeats are followed by three cysteine-rich Lin-12/Notch Repeats (LNR) and a heterodimerization (HD) domain. Together the LNR and HD compose the negative regulatory region adjacent to the cell membrane and help prevent signaling in the absence of ligand binding. NICD acts as a transcription factor that is released after ligand binding triggers its cleavage. It contains a nuclear localization sequence (NLS) that mediates its translocation to the nucleus, where it forms a transcriptional complex along with several other transcription factors. Once in the nucleus, several ankyrin repeats and the RAM domain interactions between the NICD and CSL proteins to form a transcriptional activation complex. In humans, an additional PEST domain plays a role in NICD degradation.
=== Criminal justice and law enforcement === On April 1, 2019, Pritzker created Illinois's Youth Parole system. Pritzker signed into law Senate Bill 1890, whose goal is to crack down on human trafficking. It requires hospitality business owners to train their employees to recognize victims of trafficking and to teach them the protocols of reporting to authorities. It also establishes penalties for human trafficking, including a fine of up to $100,000 and a Class 1 Felony charge. While serving in the Illinois Senate, Barack Obama sponsored an initiative that would collect data on traffic stops. This was codified when Pritzker signed House Bill 1613 into law. It creates a task force to collect and analyze data on traffic stops to address racial disparities. The task force was to report to the governor and the General Assembly by March 1, 2022, and every three years thereafter. According to the governor's office, the 2019–20 budget funded two classes of Illinois State Police cadets. In July 2019, Pritzker signed a bill that increases penalties for drivers who got involved in a road incident with injuries while texting. Under this bill, a person who causes serious injuries due to driving while texting could be fined at least $1,000 and have their driver's license suspended for a year. The law took effect immediately. In the same month, he signed House Bill 2045, ending the practice of collecting a $5 copay for offsite medical and dental treatments from people detained at a juvenile correction facility. This took effect in January 2020.
Sources: en.wikipedia.org
NMN stands for nicotinamide mononucleotide. It is a nucleotide composed of nicotinamide, ribose, and phosphate. In cells, it is an intermediate in NAD+ biosynthesis.
No, NMN and NAD+ are different molecules. NMN is a precursor that cells can convert into NAD+ through enzymatic steps. NAD+ is a larger dinucleotide that serves as a coenzyme in many reactions.
Nicotinamide riboside, or NR, is another NAD+ precursor but has a different structure. NR lacks the phosphate group present in NMN. Both are studied for their roles in NAD+ metabolism, yet they enter cellular pathways in different ways.
NMN is nicotinamide mononucleotide, a nucleotide intermediate in NAD+ biosynthesis. It consists of nicotinamide, ribose, and phosphate groups.